Home
QIIME
BLAST
EMBOSS
R-Server
Help
BLF188/20

Forward primer
Sequence: 5´ - GGAACTGAAACATCTAAGTA - 3´
Base composition: A: 9.0 C: 3.0 G: 4.0 T: 4.0
Length: 20 nucleotides
%GC: 35.0 %
Melting Temperature: 54.0 °C
Corresponding position in Escherichia coli: 188 - 207
Superposition of forward primers on a secondary structure model of Escherichia coli
Use: PCR + Sequencing
Comments:
Published in:
  • Van Camp G., Chapelle S. and De Wachter R. (1993) "Amplification and Sequencing of Variable Regions in Bacterial 23S Ribosomal RNA Genes with Conserved Primer Sequences" Cur. Microbiol. 27, 147-151 (1993)
    Designation of the primer in this publication: 11a

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:47 MEST 2003