Home
QIIME
BLAST
EMBOSS
R-Server
Help
BLR2595/20

Reverse primer
Sequence: 5´ - CGACGTTCTGAACCCAGCTC - 3´
Base composition: A: 4.0 C: 8.0 G: 4.0 T: 4.0
Length: 20 nucleotides
%GC: 60.0 %
Melting Temperature: 64.0 °C
Corresponding position in Escherichia coli: 2595 - 2576
Superposition of reverse primers on a secondary structure model of Escherichia coli
Use: PCR + Sequencing
Comments:
Published in:
  • Van Camp G., Chapelle S. and De Wachter R. (1993) "Amplification and Sequencing of Variable Regions in Bacterial 23S Ribosomal RNA Genes with Conserved Primer Sequences" Cur. Microbiol. 27, 147-151 (1993)
    Designation of the primer in this publication: 93ar

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:48 MEST 2003