Home
QIIME
BLAST
EMBOSS
R-Server
Help
BLR463/20

Reverse primer
Sequence: 5´ - CGGTACTGGTTCACTATCGG - 3´
Base composition: A: 3.0 C: 5.0 G: 6.0 T: 6.0
Length: 20 nucleotides
%GC: 55.0 %
Melting Temperature: 62.0 °C
Corresponding position in Escherichia coli: 463 - 444
Superposition of reverse primers on a secondary structure model of Escherichia coli
Use: PCR + Sequencing
Comments:
Published in:
  • Van Camp G., Chapelle S. and De Wachter R. (1993) "Amplification and Sequencing of Variable Regions in Bacterial 23S Ribosomal RNA Genes with Conserved Primer Sequences" Cur. Microbiol. 27, 147-151 (1993)
    Designation of the primer in this publication: 23ar

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:47 MEST 2003