Home
QIIME
BLAST
EMBOSS
R-Server
Help

Primers for Bacterial LSU rRNA


Click on any of the following primer names for detailed information about the primer
Primername          5´- Sequence -3´               Location
BLF188/20 GGAACTGAAACATCTAAGTA LSU rRNA BLR463/20 CGGTACTGGTTCACTATCGG LSU rRNA BLF1055/20 GGATGTTGGCTTAGAAGCAG LSU rRNA BLF1380/20 GGACAACAGGTTAATATTCC LSU rRNA BLR1686/20 GGGGCCATTTTGCCGAGTTC LSU rRNA BLR1929/20 CTTAGGACCGTTATAGTTAC LSU rRNA BLF2581/20 GGGTTCAGAACGTCGTGAGA LSU rRNA BLR2595/20 CGACGTTCTGAACCCAGCTC LSU rRNA BLR2763/20 CCCGCTTAGATGCTTTCAGC LSU rRNA

Document last updated: Tue Jul 15 12:00:49 MEST 2003