Home
QIIME
BLAST
EMBOSS
R-Server
Help
BSF8/20

Forward primer
Sequence: 5´ - AGAGTTTGATCCTGGCTCAG - 3´
Base composition: A: 4.0 C: 4.0 G: 6.0 T: 6.0
Length: 20 nucleotides
%GC: 50.0 %
Melting Temperature: 60.0 °C
Corresponding position in Escherichia coli: 8 - 27
Superposition of forward primers on a secondary structure model of Escherichia coli
Use: PCR + Sequencing
Comments:
Published in:
  • Wilmotte A., Van der Auwera G. and De Wachter R. (1993) "Structure of the 16S ribosomal RNA of the thermophilic cynobacterium Chlorogloeopsis HTF (´Mastigocladus laminosus HTF´) strain PCC7518, and phylogenetic analysis" FEBS Letters 317, 96-100
    Designation of the primer in this publication: 1

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:41 MEST 2003