Home
QIIME
BLAST
EMBOSS
R-Server
Help
BSR45/20/LSU rRNA

Reverse primer
Sequence: 5´ - TTTGCGGCCGCTCTGTGTGCCTAGGTATCC - 3´
Base composition: A: 2.0 C: 9.0 G: 9.0 T: 10.0
Length: 20 nucleotides
%GC: 60.0 %
Melting Temperature: 96.0 °C
Corresponding position in Escherichia coli: 45 - 26
Use: PCR + Sequencing
Comments: This primer lies in the LSU rRNA and is thus not superimposed on the primary and secondary structure diagrams.
Published in:
  • Wilmotte A., Van der Auwera G. and De Wachter R. (1993) "Structure of the 16S ribosomal RNA of the thermophilic cynobacterium Chlorogloeopsis HTF (´Mastigocladus laminosus HTF´) strain PCC7518, and phylogenetic analysis" FEBS Letters 317, 96-100
    Designation of the primer in this publication: 18

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:43 MEST 2003