Home
QIIME
BLAST
EMBOSS
R-Server
Help

Primers for Bacterial SSU rRNA


Click on any of the following primer names for detailed information about the primer
Primername          5´- Sequence -3´               Location
BSF8/20 AGAGTTTGATCCTGGCTCAG SSU rRNA BSR65/17 TCGACTTGCATGTRTTA SSU rRNA BSF343/15 TACGGRAGGCAGCAG SSU rRNA BSF349/17 AGGCAGCAGTGGGGAAT SSU rRNA BSR357/15 CTGCTGCCTYCCGTA SSU rRNA BSF517/17 GCCAGCAGCCGCGGTAA SSU rRNA BSR534/18 ATTACCGCGGCTGCTGGC SSU rRNA BSF784/15 RGGATTAGATACCCC SSU rRNA BSR798/15 GGGGTATCTAATCCC SSU rRNA BSF917/16 GAATTGACGGGGRCCC SSU rRNA BSR926/20 CCGTCAATTYYTTTRAGTTT SSU rRNA BSF1099/16 GYAACGAGCGCAACCC SSU rRNA BSR1114/16 GGGTTGCGCTCGTTRC SSU rRNA BSF1391/17 TGTACACACCGCCCGTC SSU rRNA BSR1407/16 GACGGGCGGTGTGTRC SSU rRNA BSR1541/20 AAGGAGGTGATCCAGCCGCA SSU rRNA BSF6/18/tRNA-Ile ATTAGCTCAGGTGGTTAG tRNA-Ile BSR45/20/LSU_rRNA TTTGCGGCCGCTCTGTGTGCCTAGGTATCC LSU rRNA

Document last updated: Tue Jul 15 12:00:43 MEST 2003