Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLF2344/20

Forward primer
Sequence: 5´ - GATTTCTGCCCAGTGCTCTG - 3´
Base composition: A: 2.0 C: 6.0 G: 5.0 T: 7.0
Length: 20 nucleotides
%GC: 55.0 %
Melting Temperature: 62.0 °C
Corresponding position in Saccharomyces cerevisiae: 2344 - 2363
Superposition of forward primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments: equivalent to NLF2343/26 but shorter
Published in:

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:53 MEST 2003