Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLF2551/21

Forward primer
Sequence: 5´ - GGGAAAGAAGACCCTGTTGAG - 3´
Base composition: A: 7.0 C: 3.0 G: 8.0 T: 3.0
Length: 21 nucleotides
%GC: 52.4 %
Melting Temperature: 64.0 °C
Corresponding position in Saccharomyces cerevisiae: 2551 - 2571
Superposition of forward primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments:
Published in:
  • Van der Auwera G., Chapelle S. and De Wachter R. (1994) "Structure of the large ribosomal subunit RNA of Phytophtora megasperma, and phylogeny of the oomycetes" FEBS Letters 338, 133-136
    Designation of the primer in this publication: 24

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:53 MEST 2003