Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLF794/25

Forward primer
Sequence: 5´ - CCGTCTTGAAACACGGACCAAGGAG - 3´
Base composition: A: 8.0 C: 7.0 G: 7.0 T: 3.0
Length: 25 nucleotides
%GC: 56.0 %
Melting Temperature: 78.0 °C
Corresponding position in Saccharomyces cerevisiae: 794 - 818
Superposition of forward primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments: We have had more success with the shorter primer NLF796/21
Published in:
  • Van der Auwera G., Chapelle S. and De Wachter R. (1994) "Structure of the large ribosomal subunit RNA of Phytophtora megasperma, and phylogeny of the oomycetes" FEBS Letters 338, 133-136
    Designation of the primer in this publication: 10

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:50 MEST 2003