Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLF796/21

Forward primer
Sequence: 5´ - GTCTTGAAACACGGACCAAGG - 3´
Base composition: A: 7.0 C: 5.0 G: 6.0 T: 3.0
Length: 21 nucleotides
%GC: 52.4 %
Melting Temperature: 64.0 °C
Corresponding position in Saccharomyces cerevisiae: 796 - 816
Superposition of forward primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments: equivalent to NLF794/25 but shorter
Published in:

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:51 MEST 2003