Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLR2362/20

Reverse primer
Sequence: 5´ - ACATTCAGAGCACTGGGCAG - 3´
Base composition: A: 6.0 C: 5.0 G: 6.0 T: 3.0
Length: 20 nucleotides
%GC: 55.0 %
Melting Temperature: 62.0 °C
Corresponding position in Saccharomyces cerevisiae: 2362 - 2343
Superposition of reverse primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments: equivalent to NLR2368/26 but shorter
Published in:

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:53 MEST 2003