Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLR2368/26

Reverse primer
Sequence: 5´ - ACATTCAGAGCACTGGGCAGAAATCA - 3´
Base composition: A: 10.0 C: 6.0 G: 6.0 T: 4.0
Length: 26 nucleotides
%GC: 46.2 %
Melting Temperature: 76.0 °C
Corresponding position in Saccharomyces cerevisiae: 2368 - 2343
Superposition of reverse primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments: We have had more success with the shorter primer NLR2362/20
Published in:
  • Van der Auwera G., Chapelle S. and De Wachter R. (1994) "Structure of the large ribosomal subunit RNA of Phytophtora megasperma, and phylogeny of the oomycetes" FEBS Letters 338, 133-136
    Designation of the primer in this publication: 23

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:53 MEST 2003