Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLR2571/21

Reverse primer
Sequence: 5´ - CTCAACAGGGTCTTCTTTCC - 3´
Base composition: A: 3.0 C: 7.0 G: 3.0 T: 7.0
Length: 21 nucleotides
%GC: 50.0 %
Melting Temperature: 60.0 °C
Corresponding position in Saccharomyces cerevisiae: 2571 - 2551
Superposition of reverse primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments:
Published in:
  • Van der Auwera G., Chapelle S. and De Wachter R. (1994) "Structure of the large ribosomal subunit RNA of Phytophtora megasperma, and phylogeny of the oomycetes" FEBS Letters 338, 133-136
    Designation of the primer in this publication: 25

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:53 MEST 2003