Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLR3284/21

Reverse primer
Sequence: 5´ - TTCTGACTTAGAGGCGTTCAG - 3´
Base composition: A: 4.0 C: 4.0 G: 6.0 T: 7.0
Length: 21 nucleotides
%GC: 47.6 %
Melting Temperature: 62.0 °C
Corresponding position in Saccharomyces cerevisiae: 3284 - 3264
Superposition of reverse primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments:
Published in:
  • Van der Auwera G., Chapelle S. and De Wachter R. (1994) "Structure of the large ribosomal subunit RNA of Phytophtora megasperma, and phylogeny of the oomycetes" FEBS Letters 338, 133-136
    Designation of the primer in this publication: 31

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:55 MEST 2003