Home
QIIME
BLAST
EMBOSS
R-Server
Help
NLR816/21

Reverse primer
Sequence: 5´ - CCTTGGTCCGTGTTTCAAGAC - 3´
Base composition: A: 3.0 C: 6.0 G: 5.0 T: 7.0
Length: 21 nucleotides
%GC: 52.4 %
Melting Temperature: 64.0 °C
Corresponding position in Saccharomyces cerevisiae: 816 - 796
Superposition of reverse primers on a secondary structure model of Saccharomyces cerevisiae
Use: PCR + Sequencing
Comments: equivalent to NLR818/25 but shorter
Published in:

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:51 MEST 2003