Home
QIIME
BLAST
EMBOSS
R-Server
Help

Primers for Eukaryotic Nuclear LSU rRNA


Click on any of the following primer names for detailed information about the primer
Primername          5´- Sequence -3´               Location
NLF1624/20/SSU_rRNA TTTGYACACACCGCCCGTCG SSU rRNA NLF31/19 RCATCGATGAAGAACGYWG 5.8S rRNA NLR108/18 GCGTTCRAAGWBTCGATG LSU rRNA NLF184/21 ACCCGCTGAAYTTAAGCATAT LSU rRNA NLR204/21 ATATGCTTAARTTCAGCGGGT LSU rRNA NLF497/16 CGATAGYVRACAAGTA LSU rRNA NLR512/16 TACTTGTYBRCTATCG LSU rRNA NLF662/16 ATCTTGGTGGACGAGT LSU rRNA NLR677/16 ACTCGTCCACCAAGAT LSU rRNA NLF794/25 CCGTCTTGAAACACGGACCAAGGAG LSU rRNA NLF796/21 GTCTTGAAACACGGACCAAGG LSU rRNA NLR816/21 CCTTGGTCCGTGTTTCAAGAC LSU rRNA NLR818/25 CTCCTTGGTCCGTGTTTCAAGACGG LSU rRNA NLF1105/22 CCGAAGTTTCCCTCAGGATAGC LSU rRNA NLR1126/22 GCTATCCTGAGGGAAACTTCGG LSU rRNA NLF1410/23 TCCGCTAAGGAGTGTGTAACAAC LSU rRNA NLR1432/23 GTTGTTACACACTCCTTAGCGGA LSU rRNA NLF1677/17 GGTYAGTCGRTCCTRAG LSU rRNA NLR1694/17 TCTYAGGAYCGACTNAC LSU rRNA NLF1999/18 CCGCAKCAGGTCTCCAA LSU rRNA NLF1999/19 CCGCAKCAGGTCTCCAAG LSU rRNA NLR2016/18 CTTGGAGACCTGMTGCGG LSU rRNA NLF2075/24 GTAACTTCGGGAWAAGGATTGGCT LSU rRNA NLR2098/24 AGCCAATCCTTWTCCCGAAGTTAC LSU rRNA NLF2343/26 TGATTTCTGCCCAGTGCTCTGAATGT LSU rRNA NLF2344/20 GATTTCTGCCCAGTGCTCTG LSU rRNA NLR2362/20 ACATTCAGAGCACTGGGCAG LSU rRNA NLR2368/26 ACATTCAGAGCACTGGGCAGAAATCA LSU rRNA NLF2551/21 GGGAAAGAAGACCCTGTTGAG LSU rRNA NLR2571/21 CTCAACAGGGTCTTCTTTCC LSU rRNA NLF2763/19 GGGAGTTTGRCTGGGGCGG LSU rRNA NLR2781/19 CCGCCCCAGYCAAACTCCC LSU rRNA NLF3010/24 GCTTTTTGATYCTTCGATGTCGGC LSU rRNA NLR3033/24 GCCGACATCGAAGRATCAAAAAGC LSU rRNA NLF3090/24 AGGGAACGTGAGCTGGGTTTAGAC LSU rRNA NLR3113/24 GTCTAAACCCAGCTCACGTTCCCT LSU rRNA NLF3264/21 CTGAACGCCTCTAAGTCAGAA LSU rRNA NLR3284/21 TTCTGACTTAGAGGCGTTCAG LSU rRNA NLR3535/22 MRGGCTKAATCTCARYRGATCG LSU rRNA NLR37/18/IGS CGGTTGCAATTGCTTGGG IGS

Document last updated: Tue Jul 15 12:00:55 MEST 2003