Home
QIIME
BLAST
EMBOSS
R-Server
Help
NSF83/20

Forward primer
Sequence: 5´ - GAAACTGCGAATGGCTCATT - 3´
Base composition: A: 6.0 C: 4.0 G: 5.0 T: 5.0
Length: 20 nucleotides
%GC: 45.0 %
Melting Temperature: 58.0 °C
Corresponding position in Saccharomyces cerevisiae: 83 - 102
Superposition of forward primers on a secondary structure model of Saccharomyces cerevisiae
Use: Sequencing
Comments:
Published in:
  • Hendriks L., Goris A., Neefs J., Van de Peer Y., Hennebert G. and De Wachter R. (1989) "The Nucleotide Sequence of the Small Ribosomal Subunit RNA of the Yeast Candida albicans and the Evolutionary Position of the Fungi Among the Eukaryotes" System. Appl. Microbiol. 12, 223-229
    Designation of the primer in this publication: 2
  • Hendriks L., De Baere R., Van de Peer Y., Neefs J., Goris A. and De Wachter R. (1991) "The Evolutionary Position of the Rhodophyte Porphyra umbilicalis and the Basidiomycete Leucosporidium scotii among Other Eukaryotes as Deduced from Complete Sequences of Small Ribosomal Subunit RNA" J. Mol. Evol. 32, 167-177
    Designation of the primer in this publication: 2
  • Winnepenninckx B., Backeljau T. and De Wachter R. (1994) "Small Ribosomal Subunit RNA and the Phylogeny of Mollusca" Nautilus Supp 2, 98-110
    Designation of the primer in this publication: 2

Submitted by: Jan Wuyts

Document last updated: Tue Jul 15 12:00:44 MEST 2003