Home
QIIME
BLAST
EMBOSS
R-Server
Help

Primers for Eukaryotic Nuclear SSU rRNA


Click on any of the following primer names for detailed information about the primer
Primername          5´- Sequence -3´               Location
NSF4/18 CTGGTTGATYCTGCCAGT SSU rRNA NSF83/20 GAAACTGCGAATGGCTCATT SSU rRNA NSR102/20 AATGAGCCATTCGCAGTTTC SSU rRNA NSF370/18 AGGGYTCGAYYCCGGAGA SSU rRNA NSR387/18 TCTCCGGRRTCGARCCCT SSU rRNA NSR399/19 TCTCAGGCTCCYTCTCCGG SSU rRNA NSR581/18 ATTACCGCGGCTGCTGGC SSU rRNA NSF573/19 CGCGGTAATTCCAGCTCCA SSU rRNA NSR951/17 TTGGYRAATGCTTTCGC SSU rRNA NSF963/18 TTRATCAAGAACGAAAGT SSU rRNA NSR980/18 ACTTTCGTTCTTGATYAA SSU rRNA NSF991/16 AARAYGATYAGATACC SSU rRNA NSR1147/20 CCGTCAATTYYTTTRAGTTT SSU rRNA NSF1179/18 AATTTGACTCAACACGGG SSU rRNA NSR1438/20 GGGCATCACAGACCTGTTAT SSU rRNA NSF1419/20 ATAACAGGTCTGTGATGCCC SSU rRNA NSF1624/20 TTTGYACACACCGCCCGTCG SSU rRNA NSR1642/16 GACGGGCGGTGTGTRC SSU rRNA NSR1787/18 CYGCAGGTTCACCTACRG SSU rRNA

Document last updated: Tue Jul 15 12:00:47 MEST 2003